Description
Description
Hieff NGS® Stubby UDI Primer Kit for Illumina is a dedicated linker kit for library construction on the Illumina® high-throughput sequencing platform, including PE Adapter and UDI Primer used in next-generation sequencing library construction. The UDI Primer is a master mix of i5 and i7 Primer used with the DNA Library Prep Kit for Illumina®, and 12312-12315 are available in plate packs with 96 indexes each, allowing the construction of up to 384 double-ended unique Index-labeled libraries. All reagents provided in the kit undergo rigorous quality control and functional verification to maximize library construction stability and repeatability.
Components
|
No. |
Name |
96×1 T |
96×2 T |
96×4 T |
|
12312 |
PE Adapter |
336 μL |
672 μL |
2×672 μL |
|
UDI Primer 001-096 |
5 μL each |
10 μL each |
20 μL each |
|
|
12313 |
PE Adapter |
336 μL |
672 μL |
2×672 μL |
|
UDI Primer 097-192 |
5 μL each |
10 μL each |
20 μL each |
|
|
12314 |
PE Adapter |
336 μL |
672 μL |
2×672 μL |
|
UDI Primer 193-288 |
5 μL each |
10 μL each |
20 μL each |
|
|
12315 |
PE Adapter |
336 μL |
672 μL |
2×672 μL |
|
UDI Primer 289-384 |
5 μL each |
10 μL each |
20 μL each |
Shipping and Storage
All the components are shipped with dry ice and can be stored at -15℃~ -25℃ for 18 months.
Note
1) The concentration of PE Adapter in this kit is 15 μM, and the amount of linker used for individual library construction is adjusted according to the kit used.
2) The PE Adapter provided with this kit is a general-purpose short adapter that requires PCR amplification to obtain a complete library.
3) UDI Primer provides Index sequence tags at a concentration of 12.5 μM for sample differentiation during high-throughput sequencing.
4) Do not heat the adaptors, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. It is recommended to store it in aliquots avoiding repeated freeze-thaw and store it at 4°C for a short time.
5) The DNA library structure using the Hieff NGS® Stubby UDI Primer Kit for Illumina® kit is as follows:
6) For your safety and health, please wear a lab coat and wear disposable gloves.
7) This product is for scientific research purposes only!
Sequence information
PE Adapter for Illumina：
5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGT*C-3´
5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´
i5 Index Primer for Illumina：
5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´
i7 Index Primer for Illumina：
5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´
[i5 Index] 8 bp i5 sequence，[i7 Index]8 bp i7 sequence
The corresponding locations of each primer in 96-well plate are shown:
